find_start_stop_codons.RdBy Coghlan (2011) A little book of R for bioinformatics. https://a-little-book-of-r-for-bioinformatics.readthedocs.io/en/latest/src/chapter7.html. The functions was originally named findPotentialStartsAndStops().
find_start_stop_codons(sq)
| sq | DNA sequence |
|---|
Searches a DNA sequence using Biostrings::matchPattern(codon, sequence) to look for start and stop codons. Currently only uses the standard genetic code.
# Example sequence from Coghlan 2011 s1 <- "aaaatgcagtaacccatgccc" # Returns a list with 2 elements ## 1) locations of codons ## 2) The codon find_start_stop_codons(s1)#> $positions #> [1] 4 10 16 #> #> $types #> [1] "atg" "taa" "atg" #>